Top 7 Programming Languages Used In Video Games
The most commonly used programming languages and tools for creating video games
...pl/rpp-w-akcji, lub też z linku (przykład): , (Wykonawcy będzie podany link do konkretnego filmu na wyżej wspomnianych serwisach, z serwisów tych można też ściągnąć dany film za pomocą programu Download Helper). Po wykonaniu zrzutu obróbka w celu podniesienia jakości: usunięcie pikseli itp. w granicach możliwości, cuda nie są wymagane. Po obróbce jakościowej potrzebna będzie mała zmiana etykiet wyświetlanych w dolnej części ekranu przez TVN. W niektórych ujęciach TVN wyświetla nazwę programu i datę, a w innym fragmencie filmu TVN wyświetla imię i nazwisko gościa programu. Dlatego trzeba będzie połączyć te etykiety z dwóch ujęć (nazwę programu i imię i nazwisko gościa), dopasować wielkością do całokształtu i wkleić
...Smartphone - iOS, android, Windows, (BlackBerry) We need a Computer Vision engineer to create algorithms for a variety of objects (CV Engine) that need to be detected in any streaming video and matched to objects to a cloud based database, which has already been built. The output of CV Engine should be a JSON call. The intention is to use elastic servers for GPU processing, but could consider GPU/CUDA for a prototype. I can give you more details if you are interested in the project, you will need to sign a Non-Disclosure Agreement, even though we have a patent pending. We have also a priority list of the types of objects that need to be detected and matched. You will need to be able to make multiple detections & matches in real-time, for the demo this will be s a ...
I need cuda programmers to do this the attached file for more is a simple project and need in within 2days. Thanks.................................................
I have a simple C++ program that performs simple comparisons between matrices in many of iterations in several loops. In order to speed it up I would like to relay the iterations to the GPU. The job is to modify the given C++ code to use CUDA for doing the iterations on the GPU.I am using Microsoft Visual C++ Express 2010 and 2008. The required job is: 1- Modifying the needed parts from C++ to CUDA 2- Make sure the code is Debug, bulid and run correctly. (help me to do this in my hp laptop (with nVidia card)) 3- Testing the new code using some specified bench marks. 4- Good explanation for the done works(what parts was modified and why; how many numbers of threads was used and so on..) .
I have a small project (<5 files), that was developed under windows in vs. It links to current opencv and it needs CUDA compilation. Please write me a makefile that does the job under ubuntu 12.
Brush-up a small library for searching a substring using GPU. The library is already written and WORKING, so the task is not to write it from scratch, not to add any options, not to support multiple GPU cards, but only brush it up and make real C++ library, which can be used from C# application. Requirements: 0. C# 3.5, NVidia CUDA C++, Visual Studio 2008 1. Take the attached project and understand it 2. Rewrite and brush up C++ GPU part according to comments inside the code 3. From C# code compare performance of CPU vs. GPU search (should be at least 10 times better) 4. Implement unit-tests in test project which is pre-created for you in the solution 5. Check that the final project works on x86 and x64 in both debug and release configurations (all 2x2 = 4 options!)
hello buddy, Nice to find you! I'm from Beijing China and can you pls contact me on QQ: 2424129445? I have a project required FFMPEG+CUDA skills. Do you have interests? Thank you!
Brush-up a small library for searching a substring using GPU. Requirements: 0. C# 3.5, NVidia CUDA C++, Visual Studio 2008 1. Take the attached project and understand it 2. Rewrite and brush up C++ GPU part according to comments inside the code 3. From C# code compare performance of CPU vs. GPU search (should be at least 10 times better) 4. Implement unit-tests in test project which is pre-created for you in the solution 5. Check that the final project works on x86 and x64 in both debug and release configurations (all 2x2 = 4 options!)
This project seeks an experienced CUDA programmer to implement a specific algorithm using GPGPU technologies. The algorithm is known as "[longest common subsequence][1]" (LCS). Your implementation should meet the following requirements: * Programmed in C++ or Java (via jCUDA) * Should take only two arguments--the two strings that are being compared. You may assume only that the two strings contain characters in the lower 127 ASCII set. The strings may be the same or different lengths, and could be over 64kb. * Should return only the length of the LCS--not the sequence itself. You should use this requirement to increase efficiency over implementations that return the entire string. * Should utilize modern CUDA-enabled GPUs to calculate the LCS at least 4 tim...
Hi i m looking for someone who can do thses... Complete iptv platform Linux OS STB firmware Here is more details about the project as most of you asked me,on msg. the full description of the project will let you know when we get in touch(after I got your solution/Idea)! Server 1. Manage Server 2. Encode Server (With Cuda Support for Performance) with Buffer Server and epg server 3. User billing, advertising and other services. Standart Stream will be 512kbps
Hi, I am looking for some one to build: Complete iptv platform Linux...details if you intrested this project Additional Project Description: Here is more details about the project as most of you asked me,on msg. the full description of the project will let you know when we get in touch(after I got your solution/Idea)! source feed satellite(dvbs/s2)-->Iptvplatform(servers)-->internet-->STB. (Codec : x264) Server 1. Manage Server 2. Encode Server (With Cuda Support for Performance) 3. Buffer Server 4. EPG Server 5. User billing, advertising and other services. STB : You can decide wich STB you want to work with. ( This project must have designed for low bandwidth ) Standart Stream will be 512kbit , HD Streams 1-1.5Mbit.. any question? PM me. ...
Szukamy eksperta od interfejsu użytkownika - kogoś kto zna zaawansowany CSS/HTML oraz JQuery. Z naciskiem na zaawansowany. Parafrazując szukamy czarodzieja do frontendu webowego który wzmocni nasz zespół i pozwoli nam szybciej wyczarować cuda światowej klasy w HTML, CSS i jQuery. Jeśli: * bardzo dobrze znasz HTML (4/5), CSS (każdy), jQuery, * wiesz jak podbić UX do maksimum, niezależnie od przeglądarki, * możesz pochwalić się swoimi pracami (interfejsy, projekty, animacje, etc.), * nie masz problemu w rozmowie po angielsku, * wiesz co znaczy "rzetelność", "terminowość", "samodzielność" (bo to są Twoje zalety), * nie masz problemu z motywacją i sam sobie organizujesz pracę to jesteś osobą której szukamy i zapraszamy do kontaktu! ...
Por favor, regístrate o inicia sesión para ver los detalles.
...several loops. In order to speed it up I would like to relay the iterations to the GPU. The job is to modify the given C++ code to use CUDA for doing the iterations on the GPU. I am using Visual Express 2010, 64 Vista Professional, Nvidia on one machine and Visual Express 2010, 64 Win7, nvidia on other machine. The job would include to configure my machines to run CUDA using "logmein" in case I fail to do it myself based on your instructions. Finished job has to debug&bulid, run correctly on my machines. I would need all parts of the C++ code, except for the functions in CUDA to be available for modifications on my side without interfering with the CUDA part of the program. Please read the project first and write the word "Understood...
I have a simple C++ program that performs simple mathematical calculations over millions of iterations in seve...several loops. In order to speed it up I would like to relay the iterations to the GPU. The job is to modify the given C++ code to use CUDA for doing the iterations on the GPU. I am using Visual Express 2010, 64 Vista Professional, Nvidia on one machine and Visual Express 2010, 64 Win7, nvidia on other machine. The job would include to configure my machines to run CUDA using "logmein" in case I fail to do it myself based on your instructions. Finished job has to debug&bulid, run correctly on my machines. I would need all parts of the C++ code, except for the functions in CUDA to be available for modifications on my side without interfer...
Hi, I am looking for some one to build: Complete iptv platform Linux...details if you intrested this project Additional Project Description: Here is more details about the project as most of you asked me,on msg. the full description of the project will let you know when we get in touch(after I got your solution/Idea)! source feed satellite(dvbs/s2)-->Iptvplatform(servers)-->internet-->STB. (Codec : x264) Server 1. Manage Server 2. Encode Server (With Cuda Support for Performance) 3. Buffer Server 4. EPG Server 5. User billing, advertising and other services. STB : You can decide wich STB you want to work with. ( This project must have designed for low bandwidth ) Standart Stream will be 512kbit , HD Streams 1-1.5Mbit.. any question? PM me. ...
...multicast stream is transcoded to H264 using the ffmpeg (x264) and set to the Set-top box. The problem is that 50+ channels cant be transcoded on cpu using the x264 module. So we need a module based on hardware accelerated GPU (NVidia CUDA Tesla) You can build the module based on the CUDA api examples (see attachement) and the module has to replace the x264 module used by ffmpeg. Platform is Linux. If you are a experienced C++ programmer and you have a recent nvidia graphics card. You can build and test the code. Almost every nvidia graphics card supports CUDA. The Tesla cards are GPU processors with more power. The module is used 7x24x365 so must be solid and perform very good = NOT CRASHING!! The code written for this project will not be resold to anyo...
...the system functioning by re-assigning tasks to available nodes. Jipsam System Management Workstation notifies upon such a failure with diagnostic information to help identify the problem. Combined with flexible system architecture which allows hot-swap of system components, Jipsam supercomputing system enables continuous availability as well as high serviceability. -Compactness Built on proven CUDA computing technology, Jipsam supercomputing system provides drastically improved performance-to-cost ratio and considerably reduced power consumption as well as smaller size, which makes ideal solution for high-performance computing on lower resources. -Ease of use Jipsam system delivers powerful, easy-to-use GUI (graphical user interface)-based system management suite. This make...
...several loops. In order to speed it up I would like to relay the iterations to the GPU. The job is to modify the given C++ code to use CUDA for doing the iterations on the GPU. I am using Visual Express 2010, 64 Vista Professional, Nvidia on one machine and Visual Express 2010, 64 Win7, nvidia on other machine. The job would include to configure my machines to run CUDA using "logmein" in case I fail to do it myself based on your instructions. Finished job has to debug&bulid, run correctly on my machines. I would need all parts of the C++ code, except for the functions in CUDA to be available for modifications on my side without interfering with the CUDA part of the program. Please read the project first and write the word "Understood...
I have a simple C++ program that performs simple mathematical calculations over millions of iterations in seve...several loops. In order to speed it up I would like to relay the iterations to the GPU. The job is to modify the given C++ code to use CUDA for doing the iterations on the GPU. I am using Visual Express 2010, 64 Vista Professional, Nvidia on one machine and Visual Express 2010, 64 Win7, nvidia on other machine. The job would include to configure my machines to run CUDA using "logmein" in case I fail to do it myself based on your instructions. Finished job has to debug&bulid, run correctly on my machines. I would need all parts of the C++ code, except for the functions in CUDA to be available for modifications on my side without interfer...
This project ope...software graphics engine will need to be fully compatible with Nvidia 3D vision and Nvidia 3D TV - which will be the case for DirectX 9c onwards with polygon or voxel 3D particles. CUDA based acceleration is a plus . But a simple non CUDA based viewer for non NVIDIA graphics will be required for viewing 3D depictions on android and iOS and windows / mac browser. Unity 3D is preferred as the simple viewing platform for android, ios and browsers. The native windows application will need to be fully accelerated employing ultra smooth graphics on Nvidia high end GPU systems - hence preference for CUDA programming to speed up calculations for both preprocessing and graphics. Software will need to be well coded for high stability so tha...
Project name:High Performance 3D Medical PACS Solution Constructing Low-cost 3D PACS, urgent demand of medical field NCT¡¯s New 3D Medical PACS Solution MG-3000M NCT has recently developed new 3D medical analyzing system that supplies possibility of simultaneous and multiple access to the 3D medical image data with high performance of infrastructure and software. This solution includes the low cost real-time 3D medical analysis Workstation system and model calculation programs, which can get the result of 3D heart and brain blood vessel molding estimation within 2~3ms. NCT¡¯s 3D medical PSCS actually gives customers the highest effects at the lowest cost. We are updating the system continuously and more conveniently according to the needs of customer...
Hello, I would like to optimize my existing code by implementing with OpenCL. See below for more details: ## Deliverables I have an existing code, not very big and complex, simple Fourier Transform implementation on an Image. This code is to be implemented in C++ with OpenCL + CUDA optimization, two versions. The final deliverable of this project will be the optimized code for GPU. Please contact me for further details. IMPORTANT PLEASE NOTE: I will talk to experts in GPU programming only! Hence, the respected coders must be able to showcase their past projects on similar lines. Good Luck!
ROLE: Sytel seeks a Software Developer who is self-motivated and passionate about software development. This role will require the ability to learn ...strong ability to solve problems and think laterally. c) Strong English oral and written communication skills. d) A demonstrable record of achievement in either previous position(s), or academic work. DESIRABLE SKILLS / EXPERIENCE: a) Apache and PHP, Web Service development. b) Relational databases such as Microsoft SQL Server or MySQL. c) Profiling of issues involving excessive GPU usage CUDA , Cloning a ++ no copyright problems here You may have experience of the following: C++ Developer, C# Programmer, C++ Programmer, Web Application Developer, C# Developer, .NET Software Developer, Analyst Programmer, Software Eng...
...GTTCCCAAGTTAA will merge into: GTTCCCAAGTTAAAAGTTAAATGAGA because AAGTTAA is a an overlapping string between them. So basically, for every set of strings with overlap between the you are looking for "the shortest common superstring" that both of them are sub-strings of it. I have some variation to this process, which I'll explain in detail later. I need the software to work in parallel on CUDA. The amount of data here is massive. Millions of strings, each of length 40~150. There are some known algorithms how to quickly construct overlap graphs (look for ABySS assembler for example) using hash tables, prefix graph etc. There should be at least a basic GUI to load a file, watch the progress and get statistics about the output. THE MAIN TASK HERE IS: ...
I need CUDA programmers who can write a program for Multiple sequence alignment. Both the simple project only but code has to written with explanation and in a very simple way. Easily understandable. I have both the programs written in C but I need it in CUDA C or atleast in CUDA python. Time constraint is the main problem. Your help would be very much appreciated.
Witam. Chciałbym zlecić napisanie aplikacji w C++ z wykorzystaniem technologii CUDA. Program najlepiej mógłby ukazywać szybkość działania CPU i GPU(różnice w szybkości działania). Chętnych proszę o kontakt poprzez pw, tam będą dalsze informacje. Pozdrawiam
I am in possession of a Support Vector Machine algorithm that is already coded and tested in C++. I am certain that it works correctly. I am also in possession of an NVIDIA GT 430 VGA. I have ported the existing algorithm to CUDA and it still works in a serial fashion (without kernels implemented). I have confirmed this by comparing the output files from each version. I simply need some small sections of the serial code rewritten as kernels (having threads operating in parallel that achieve the same result faster) as proof of concept that GPU computing is faster than traditional computing. I do not need all possible situations where parallelization is possible to be parallelized and optimized, however I need the most time consuming 5-7 parts of code changed and optimized to ...
Tutorial on how to start programming in CUDA.
I want a serial program and parallel program which uses cuda to solve jacobi method. Also I need final report for this project. the final report should compare the speed up and the efficiency and should explain each part of the program and should include: - Project description - Research/Design - Implementation - Testing/Samples - Result analysis [Have the goals been reached?] - User guide - References
I have a C++ program that has to iterate over a lot of integer math operations. It is already written for parallel CPUs using OpenMP. If you know CUDA, this should take a few hours to port it and test it. The simple algorithm uses 128 bit integers. In your bid, please answer the following question, so I can weed out people who do not already know CUDA: How would you do a 128 bit integer multiply?
ROLE: Sytel seeks a Software Developer who is self-motivated and passionate about software development. This role will require the ability...strong ability to solve problems and think laterally. c) Strong English oral and written communication skills. d) A demonstrable record of achievement in either previous position(s), or academic work. DESIRABLE SKILLS / EXPERIENCE: a) Apache and PHP, Web Service development. b) Relational databases such as Microsoft SQL Server or MySQL. c) Profiling of issues involving excessive GPU usage CUDA , You may have experience of the following: C++ Developer, C# Programmer, C++ Programmer, Web Application Developer, C# Developer, .NET Software Developer, Analyst Programmer, Software Engineer etc. Salary: 1000 USD /month one year ...
...work faster as a praller application on a GPU. I need it to be done in CUDA - Visual Studio 2010. Plus make comparison of the speed to the CPU implementation versions. ALGORITHM WILL COMPARE 2 LONG SEQUENCES SO IT IS ENOUGH IF COMPARISON PART IF ALGORITH IS MADE PARALLEL FOR FORST IMLEMENTATION - LATER I HOPE FOR LONG COOPERATION. Tutorial must be very datailed, written so that person with no knowledge on programming on CUDA could learn and make both the programs workable by him/her self. So I need a tutorial that will let me implement the algorithm normally that will work on CPU and than how to optimalize to work parallel on CPU and implement it in CUDA. Step by step from the very scratch like installation of CUDA or compiler etc. So not only codes ...
I look for a freelancer to constant cooperation in implementing alhorithms in CUDA technology. Comparing their performance to CPU implementaion and documenting it will be essential. We require Visual Studio 2010. For more deatails on current algorithm and further cooperation please leave message.
Poszukujemy programisty w technologii nVidia CUDA który będzie wykonywał różne drobne programy/algorytmy w tej technologii. Umowa o dzieło. Możliwość wystawienia referencji oraz zaświadczenia z praktyk. Stawka za każde zlecenie oraz deadline ustalany indywidualnie.
We look for a freelancer to constant cooperation in implementing alhorithms in CUDA technology. Comparing their performance to CPU implementaion and documenting it will be essential. We require Visual Studio 2010. For more deatails on current algorithm and further cooperation please leave message.
witam zlece napisanie unikalnego tekstu / artykułów składających się z 1500-2000 znaków o Islandii , z tematów: Historia Waluta Władza i polityka Gospodarka Ludność Język Klimat Zdrowie Podział terytorialny Elektryczność Geotermalne cuda natury Rzeki i wodospady Lodowce Zorza polarna Fauna i flora Jazda konna Wędkarstwo Pływanie Golf Rower Narciarstwo artykułów jest 20 , proszę o podanie ceny za 1 artykuł.. teksty musza byc unikatowe , odzwierciedlające i zawierające prawdziwe informacje.
We want a developer to supply and application to do a 2d rotation in CUDA. Input will be a tif file and output will be another tif file rotated by an arbitrary number of degrees positive or negative.
witam zlece napisanie unikalnego tekstu / artykułów składających się z 1500-2000 znaków o Islandii , z tematów: Historia Waluta Władza i polityka Gospodarka Ludność Język Klimat Zdrowie Podział terytorialny Elektryczność Geotermalne cuda natury Rzeki i wodospady Lodowce Zorza polarna Fauna i flora Jazda konna Wędkarstwo Pływanie Golf Rower Narciarstwo artykułów jest 21 , proszę o podanie ceny za 1 artykuł.. Proszę załączyć info o portfolio, ew co się komu pisało prosze zwazyc na to ze nie spieszy mi sie , z artykułami wiec mozna je spokojnie sobie pisac powiedzsmy przez miesiac. zalezy mi na cenie i doswiadczeniu w pisaniu
...tutorial how to implement a dynamic programming algorithm (of my choose) first normally on CPU and than how to make it work faster as a praller application on a GPU. I need it to be done in CUDA. Plus comparison of the speed to the CPU implemented version. Tutorial must be very datailed, written so that person with no knowledge on programming on CUDA could make both the programs workable by him/her self. So I need a tutorial that will let me implement the algorithm normally that will work on CPU and than how to optimalize it and implement in CUDA. Step by step from the very scratch like installation of CUDA or compiler etc. So not only codes to copy and pasete should be in tutorial but also description of algorithms and optimalizations and what thay do ...
Implementation of Floyd-Warshall algorithm in CUDA, for computing the optimal path among all pairs of vertices (All Pairs Shortest Path) in a directed graph with non negative edge length. Consider a graph whose set of vertices is {1, 2,?.,n}. The input of the program will be an n*n matrix A, float type, where A[i][j]=0 when i==j cost of the edge (i,j) Inf for non existing edges Output: a) n*n matrix D(float type) where the D[i][j] element will be the sortest path from the node i to node j or Inf if no such path exists. b) n*n matrix int Q where the Q[i][j] element will be the intermediate node that exists between the nodes i and j, or 0 if the edge( i, j) is the sortest path from i to j, or Inf if there is no such path. The pair of matrices D and Q sho...
We need a person who knows GPU CUDA and he will only explain some psue codes and hints via internet not need to write codes.
We need a programmer(s) with extraordinary skills in CUDA and C++ (Visual Studio 2010) and ability to debug an existing software . Will be supplied with a C++ program . This program needs some debugging and testing on a CUDA compliant machine (i.e. having an NVIDIA graphics card that has CUDA capability, e.g .2.0 ,2.1 ). This is required quite urgently. For someone that has done some limited programming in C++ on a CUDA graphics card, this task shouldn't take long. Can either work in Windows (Visual C++) Developer will have to work remote on Team-viewer and good communicative in English . We are looking for LONG TERM relationship. If you have no CUDA experience or just basic SDK experience, please don't apply. I treat my free...
...tutorial how to implement a dynamic programming algorithm (of my choose) first normally on CPU and than how to make it work faster as a praller application on a GPU. I need it to be done in CUDA. Plus comparison of the speed to the CPU implemented version. Tutorial must be very datailed, written so that person with no knowledge on programming on CUDA could make both the programs workable by him/her self. So I need a tutorial that will let me implement the algorithm normally that will work on CPU and than how to optimalize it and implement in CUDA. Step by step from the very scratch like installation of CUDA or compiler etc. So not only codes to copy and pasete should be in tutorial but also description of algorithms and optimalizations and what thay do ...
Optimization of various image processing functions on sgx 535 gpu (gma500 used in Intel Atom). Requires knowledge in gpgpu and shaders since the processor doesn't support cuda or opencl. If the results of some basic functions are satisfactory the project will be prolonged for more complicated functions.
Por favor, regístrate o inicia sesión para ver los detalles.
Zlecę przygotowanie i przeprowadzenie szkolenia programowania w CUDA.
I need a very detailed tutorial how to implement Smith-Waterman algorithm normally on CPU and how to make it work faster as a praller application on a GPU. I need to be done in CUDA. Plus comparison of the speed to be implemented in the program. Tutorial must be very datailed, written so that person with no knowledge on programming or CUDA could make the programs workable by him/her self.
We are looking for a developer with experience into Cuda development. We need a library that will detect driver versions of installed Cuda and some other features, Cuda have. *Note: This bid request is not for video or directx development* We need the infos: - Is Nvidia Cuda Driver installed - Is Nvidia Driver Quadro or GeForce - Driver version number - Count of graphic cards - Name of Graphiccard X (count index) - HasSystem Nvidia Optimus - IsNvidiaActive (On Optimus system) Develop a Library or class. That we can link with our software. The library have to be developed with C++, Unicode settings. No dotNet code. Please ask if you have questions.
I am interesting in project, consist if two program: 1) OpenNI grabber of data to harddisk *.oni files, each 5 min of recording. Input data: Switching between Depth and Depth+Image Program may be console apps 2) Program, that batch process *.oni files from step 1. It `s program must do, as http:...may be console apps 2) Program, that batch process *.oni files from step 1. It `s program must do, as Make cave mapping with loop closure. Output data: 1) 3d result point cloud in pcd format 2) 2d jpeg or bmp file of result map Program must: Windows XP use OpenNI driver Recomended use: 1) PCL library 2) CUDA for program #2 3) Interest see project GMapping and RGBDSlam at
The most commonly used programming languages and tools for creating video games
This article is a guide for anyone interested in using machine learning frameworks in their organization.